|
Spotlight on the expanding role of miR-647 in human cancers
Mohammadmahdi Jalili1, Setayesh Tavakoli1, Kamran Kargar2, Milad Rafat3, Fatemeh R Rad3
1 Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
2 Department of Prosthodontics, Shahed Medical University, Tehran, Iran
3 Student Research Committee, University of Social Welfare and Rehabilitation Sciences, Tehran, Iran
| Date of Submission | 29-Oct-2022 |
| Date of Acceptance | 08-Feb-2023 |
| Date of Web Publication | 30-Jun-2023 |
Correspondence Address:
Dr. Fatemeh R Rad
Student Research Committee, University of Social Welfare and Rehabilitation Sciences, Tehran
Iran
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/abr.abr_369_22
MicroRNAs are a large group of small, non-coding ssRNAs (miRNAs) that have an epigenetically pivotal role in gene expression and other biological processes in cells and can be regarded as capable biomarkers for the early detection and management of cancer. The aim of the present review article is to summarize the evidence for recognizing the molecular mechanism, target genes, and clinical significance of miR-647 in different cancers. Multiple studies have demonstrated that aberrant expression of miR-647 could be found in a variety of malignancies, such as bladder cancer, cervical cancer, colorectal cancer, gastric cancer, glioma, hepatocellular carcinoma, non-small cell lung cancer, ovarian cancer, and prostate cancer have reported, notably, increase or decrease in expression of miR-647 so that it can function as a tumorigenic (oncomiR) or tumor suppressor gene. MiR-647 is effective in the proliferation, migration, and invasion of cancer cells by playing a function in cell cycle pathways. MiR-647 can be a valuable potential biomarker for assessing the extent of cancer, prognosis, and response to therapy and shows great therapeutic efficacy in different solid tumors. Moreover, serum concentrations of miR-647 are directly effective in decreasing overall survival and disease progression. So, an efficient therapeutic target can be the effect on miR-647 expression by antitumor drugs.
Keywords: Biomarker, cancer, microRNA, microRNA-647, miR-647
How to cite this article:
Jalili M, Tavakoli S, Kargar K, Rafat M, Rad FR. Spotlight on the expanding role of miR-647 in human cancers. Adv Biomed Res 2023;12:170 |
| Introduction | |  |
Up to less than 2% of the human genome consists of 20,000 protein-coding genes. It has been found that at least 70% of the genome sequences are transcribed into RNAs, and most of these transcripts have been determined as non-coding RNAs (ncRNAs).[1],[2],[3],[4],[5] Ongoing advances in large-scale genome sequencing revealed that long nRNAs (more than 200 nucleotides) and short ncRNAs (less than 20 nucleotides) are the major regulators of the human genome.[6],[7],[8] MicroRNAs are a large group of small, non-coding ssRNAs that are endogenous and regulated across the mammalian genome. The human genome can encode around 1000 types of microRNAs. They are found in eukaryotes and are, on average, 22–24 nucleotides in length.[9] Their primary role is to post-transcriptionally control gene expression. In this way, they interact with mRNA and silence the target gene. The majority of microRNA genes are generated in the intron regions of other genes and transcripted by RNA polymerase II.[10] More intense studies are necessary to identify new biological events concerning carcinogenesis and new therapeutic targets such as microRNAs. The microRNAs have been aberrantly expressed in different cancerous tissues so that their expression can be increased, decreased, or remain stable.[11]
In the human body, MiR-647 is made of two homologous miRNAs on human chromosome 20q13.33, hsa-miR-647-5p and hsa-miR-647-3p.[12] The Rfold web server (Vienna package) was employed to predict and plot the secondary structure of miR-647 with a minimum free-energy of -42.70 kcal/mol and dot-bracket notation (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi) [Figure 1]. The MiR-647 evolved conservatively with similar structure and sequence in humans, mice, flies, and other species. MiR-647 regulation is essential in biological processes to make sure the existence of a physiological balance between human body systems. Some studies have demonstrated that miR-647 elevates cell proliferation and invasion and stimulates apoptosis in numerous cancers at the functional level.[15],[20] Emerging evidence verified that miR-647 plays a critical role in various cancers [Table 1]. | Figure 1: Prediction of Optimal Secondary structure of the has-miR-647 (EPS format) with -42.70 kcal/mol with its dot-bracket notation using the Rfold web server. The sequence of this microRNA: AGGAAGTGTTGGCCTGTGGCTGCACTCACTTC CTTCAGCCCCAGGAAGCCTTGGTCGGGGGCAG GAGGGAGGGTCAGGCAGGGCTGGGGGCCTGAC
Click here to view |
| Materials and Methods | | |
As mentioned above, researchers have selected two approaches. The first strategy was to search all articles and records released since 2000 in PubMed, Scopus, Embase, Google Scholar, and Cochrane databases utilizing MIRN647, MiRNA647, Hsa-Mir-647, MicroRNA 647, and Hsa-miR-647 keywords. Inclusion criteria comprised the expression and biological mechanisms of miR-647 in the tumorigenesis of various cancers.
Besides, the second strategy aimed to detect the targeted genes of miR-647 and dependent pathways engaged in carcinogenesis following prediction in relevant databases specific to microRNAs, like Software available in DIANA-miRPath v3. 0 (http://snf-515788.vm.okeanos.grnet.gr/), Tarbase V.8 (http://carolina.imis.athena-innovation.gr/diana_tools/web/index.php?r=tarbasev8/index), and ultimately KEGG database (available at www.genome.jp/kegg/pathway.html).
| Changes miR-647 in Different Tumors | | |
Bladder cancer
One widespread urological malignancy is bladder cancer, the 10th most common cancer in the world. The availability of several treatments has resulted in a high five-year survival rate for bladder cancer (BC) patients.[13] Almost 33–75% of cases with bladder cancer are treatment-resistant because of metastasis or relapse of the disease. Furthermore, biomarkers such as microRNAs are considered important factors that improve or decrease the risk of clinically important events such as cancer episodes, expansion, recurrence, or patient deaths.[14] In one study, Du et al. (2021) extracted three differentially expressed circRNAs (has_circ_0023642, has_circ_0047322, has_circ_0041151) from the microarray dataset (GSE92675) in bladder cancer. They also detected four miRNAs (miR-616, miR-515-5p, miR-647, and miR-1178) that have potential binding sites with these three circRNAs.[15]
Cervical cancer
Globally, cervical cancer is the fourth common leading cause of cancer death in women, with an estimated 604,000 women distinguished with this condition and about 342,000 of them dying in 2020.[16] However, ~85% of the global deaths from cervical cancer occur in developing or underdeveloped countries, with the rate 18 times greater than in middle- and low-income countries compared to developed countries.[17] In addition, a vast majority of this type of cancer is due to the human papillomavirus infection. However, an important portion of this condition is self-evidence.[18],[19] In functional experiments, Yang et al. (2020) demonstrated that ZFAS1 facilitated CC tumor growth and metastasis in vivo, as well as cell proliferation, migration, and invasion in vitro. These results indicated that METLL3-mediated m6A modification arranged the sequestration of miR-647 by ZAFS1.[20]
Colorectal cancer
Following the GLOBOCAN 2020 information, colorectal cancer (CRC) has been introduced as the third leading cause of carcinogenic death in both genders and fourth-most typically diagnosed cancer occurring worldwide. About two million new CRC cases and nearly one million fatalities were estimated in 2020. Based on the studies, a global rise in CRC occurrence was also seen, generally in developing countries adopting the “western” lifestyle.[21] Even though the remarkable advancements in the molecular mechanism recognition and treatment of CRC through surgical resection, radiation therapy, chemotherapy, prognosis, and general survival, this cancer still requires further progress.[22],[23] One study by Liu et al. (2017) revealed that miR-647 and miR-1914 promote the proliferation and migration of CRC cells by targeting NFIX in straight. Moreover, targeted delivery of siRNAs can turn off miR-647/1914, causing overexpression of NFIX, a practicable approach for CRC treatment.[24]
Gastric cancer
It has been reported that the second top reason for cancer death worldwide is gastric cancer. Although there are many advances in treating Gastric cancer (GC), patients have poor prognoses. Because of lacking appropriate biomarkers to determine GC initially, the five-year survival rate is low. It is fascinating to note that the sensitivity and specificity of CA125 and CEA (carcinoembryonic antigen) are limited in clinical settings, even with combined utilization, because they are not unique for GC diagnosis. Therefore, new methods based on molecular techniques are necessary to distinguish this disorder as soon as possible.[25] The study has been done by Ye et al., (2017) who indicated that miR-647 could function as a tumor suppressor in gastric cancer by targeting the SRF/MYH9 axis to inhibit metastasis.[26] In another study, Zhang et al. (2018) stated that TP73 had noticeably declined subsequent miR-647 overexpression and substantially increased subsequent miR-647 suppression. Overexpression of miR-647 causes increasing proliferation, migration, and invasion of MGC-803 cells and decreasing percentage of apoptotic cells. Totally, miR-647 plays the role of a tumor enhancer in gastric cancer by repressing TP73.[27] Ma et al., in their study, showed that the expression of serum miR-647 was significantly downregulated in patients with gastric cancer. Receiver-operating characteristic curve analyses revealed that serum miR-647 had a high efficiency for differentiating patients with GC from healthy controls. Additionally, low expression of miR-647 in serum was related to aggressive clinical characteristics and poor survival in GC. Mechanistically, since miR-647 downregulates in GC cell lines, it induces an increase in the expression levels of STX6, STX7, and PRKCA. Finally, their results clearly illustrated that serum miR-647 might act as a novel serum biomarker to follow up the GC progression.[28]
Glioma
Gliomas are the most prevalent kind of primary adult intracranial tumors. Some glioma subtypes result in morbidity and, in some cases, mortality incommensurate to their partially rare incidence.[29] Albeit Gliomas are more prevalent in aged adults, as they contain 8% of all pediatric brain tumors. In spite of multidisciplinary approaches to therapy, such as aggressive surgery, chemotherapy, and radiation, the median survival among some patients with this condition is just 12–15 months.[30] In one study, the results of Qin et al. (2020) showed that miR-647 expression was considerably downregulated in Glioblastoma Multiforme (GBM) cell lines in contrast to healthy cells. This overexpression of miR-647 prevents glioma cell proliferation, colony formation, and cell invasion but elevates apoptosis in vitro. HOXA9 was confirmed to be a direct target of miR-647, and the HOXA9 overexpression inverted the impacts of miR-647 on glioma cell behavior.[31]
Hepatocellular carcinoma
Yearly, 600,000 people die because of Hepatocellular carcinoma (HCC), so the disease is the third most cause of mortality due to cancer on the global scale. Besides, chronic infection with the hepatitis B and C viruses can be involved in developing HCC. In addition, intracerebral and bone metastasis causes a poor prognosis and a higher recurrence rate in early HCC,[32] regardless of the extraordinary therapeutic progress in the treatment of HCC, such as hepatic resection and chemotherapy, the prognosis outcomes of the patients are still inefficacious due to the growth of disseminated tumor metastases.[33] Theoretically, hepatocarcinogenesis depends on two prime principles: the activation of oncogenes or the inactivation of tumor suppressor genes.[34] In this way, focusing on differentiating the causes of HCC can provide a correct understanding of its initial diagnosis and treatment. Ye et al. (2022) reported that, opposite to the Protein Tyrosine Phosphatase Receptor Type F (PTPRF) effect, miR-647 could elevate the proliferation, migration, and invasion of HCV-huh7.5 cells. Besides, the functional testing results indicated that miR-647 overexpression or PTPFRF inhibition significantly affected the signaling of the Erk pathway, which could modulate cell growth, migration, and invasion. Moreover, using a dual luciferase reporter assay, they recognized PTPRF as a direct target of miR-647. Their results provided evidence of the role of miR-647 in promoting the biology of HCV-huh7.5 cells by preventing PTPRF expression.[35]
Non-small cell lung cancer
Non-small cell lung cancer (NSCLC) is the highest recurring lung cancer and the most-deadly malignant tumor in the world, responsible for about 1.5 million deaths in 2012.[36] In Europe, out of 353,000 die annually because of the disease, about 20% of them occur due to cancer.[37] Nearly, 70% of patients with lung cancer are because of NSCLC, a significant type with a poor prognosis after chemotherapy. So, predicting molecular targets and biomarkers for lung cancer is essential.[38] Zhang et al., in one study that was conducted in 2018, claimed that overexpressing TRAF2 somewhat causes rescuing of the suppressive function of miR-647 in A549 and H1299 cells. Also, their results show that miR-647, by attenuating the NF-κB pathway, induces repression of lung carcinogenesis; in other words, they demonstrated that miR-647 as a tumor suppressor impacts NSCLC by the downregulation in expression of TRAF2 and the NF-κB signaling pathway.[39] Jiang et al. (2021) announced that miR-647 inhibits proliferation and improves cisplatin-induced cell apoptosis in NSCLC by downregulation in IGF2 expression.[40]
Ovarian cancer
According to the research, OC has been found to be one of the most malignant tumors of the women's reproductive system that has the first rank of mortality rates among gynecological cancers.[41] Treatment for OC principally involves platinum-based chemotherapy and surgical removal of the tumor.[42] As the population age gradually rises, the incidence of ovarian cancer (OC) has increased annually.[43] OC is usually diagnosed in advanced stages due to the absence of specific early clinical symptoms.[44] Therefore, investigating the molecular mechanism involved in the development of OC is necessary to identify effective tumor markers in diagnosing and treating OC. Sun et al. (2019) evidenced that circ-FAM53B, as a competing endogenous RNA (ceRNA) competitively sponged miR-646 and miR-647, provoking upregulation of VAMP2 and MDM2 expression at the post-transcriptional level. This mechanism mediates the OC cells' behaviors.[45]
Prostate cancer
Prostate cancer (PCa) is the commonest male malignancy and the second leading cause of mortality among men, responsible for approximately 21% of all new cancer cases and 10% of all deaths in men.[46] Despite the fact that androgen deprivation therapy can be used as primary therapy for patients with non-metastatic PCa,[47] many patients displayed poor prognoses because of tumor metastasis.[48] Thereby, it is an urgent need to examine novel diagnostic and therapeutic biomarkers as well as underlying molecular mechanisms in PCa progression. Chen et al. (2021) reported that CircNOLC1, raised by the transcription factor NF-κB, creates PCa progression through the miR-647/PAQR4 axis. This procedure causes PI3K/Akt pathway activation, so circNOLC1 is a potential biomarker and therapeutic target for PCa.[49]
| MiR-647 Regulatory Mechanisms | | |
The emerging evidence mentioned above manifests that miR-647 plays a key role in various cancers and leads to cancer progression through known pathways, comprising PI3K, JAK/STAT, MAPK signaling, apoptosis pathways, Chromatin organization, and signaling by GPCR. Also, all of these pathways associate mutually and have a central function in tumor cell growth, differentiation, and proliferation, as well as migration and invasion in various kinds of tumors.
MiR-647 takes part in different pathways, which are referred to in [Table 2]. The outcomes of bioinformatics work employing DIANA-miRPath, Tarbase, and KEGG pathways illustrate that miR-647 is closely related to other additional pathways, including steroid biosynthesis, adherence junction, thyroid hormone signaling pathway, transcriptional misregulation in cancer, endometrial cancer, hippo signaling pathway, and Wnt signaling. | Table 2: DIANA-miRPath v3. 0 and Tarbase v8. experimentally supported interactions for hsa-miR-647
Click here to view |
| Conclusion | | |
MicroRNAs play fundamental regulatory functions in gene expression, and their dysregulation is observed in many human malignancies. Studies highlighted that miR-647 is a ncRNAs that performs a crucial role in cancer development with acceleration in invasion, migration, rapid growth, and proliferation of malignant cells. The evidence hypothesizes that miR-647 is a tumor suppressor in some cancers, while in others, it has played a tumorigenic role (oncomiR). The mechanism through which miR-647, by rising or declining in its gene target, acts a function in carcinogenesis and metastasis. Notably, some studies argue that abnormal miR-647 expression leads to increased tumor growth. Accordingly, as for the functional impact of miR-647 in the cellular pathways, it acts as a marker for assessing the extent of cancer, prognosis, and response to therapy and shows great therapeutic efficacy in different solid tumors. Moreover, serum concentrations of miR-647 are directly effective in decreasing overall survival and disease progression. So, an efficient therapeutic target can be the effect on miR-647 expression by antitumor drugs. Considering the roles of this microRNA in the diagnosis, prognosis, and treatment of the aforementioned cancers, it can probably be employed in cancer gene panels for clinical practice. Therefore, further studies and bioinformatic works on miR-647 dysregulation may provide novel sensitive diagnostic and prognostic markers, as well as therapeutic options for some cancers.
| Future Prospect | | |
An accurate examination of the upstream and downstream mechanisms of miR-647 is still needed to study and review it better. The miR-647 might be clinically suggested as a multipurpose biomarker for the diagnosis and prognosis, cancer progression, and even assessing the efficacy of treatment. The miR-647 may, therefore, be employed as a novel therapeutic target in cancer treatment, and it can eventually become a crucial clinical treatment approach.
Ethical approval
This study was performed without any human or animal model experiments by the authors.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
| References | | |
| 1. | Djebali S, Davis CA. Merkel A, Dobin A, Lassmann T, Mortazavi A, et al. Landscape of transcription in human cells. Nature 2012;489:101-8.  |
| 2. | Lee JT. Epigenetic regulation by long non-coding RNAs. Science 2012;338:1435-9. |
| 3. | Rafat M, Moraghebi M, Afsa M, Malekzadeh K. The outstanding role of miR-132-3p in carcinogenesis of solid tumors. Hum Cell 2021;34:1051-65. |
| 4. | Kambara H, Niazi F, Kostadinova L, Moonka DK, Siegel CT, Post AB, et al. Negative regulation of the interferon response by an interferon-induced long non-coding RNA. Nucleic Acids Res 2014;42:10668-80. |
| 5. | Li Z, Shen J, Chan MTV, Wu WKK. TUG 1: A pivotal oncogenic long non-coding RNA of human cancers. Cell Prolif 2016;49:471-5. |
| 6. | Jiang X, Ma N, Wang D, Li F, He R, Li D, et al. Metformin inhibits tumor growth by regulating multiple miRNAs in human cholangiocarcinoma. Oncotarget 2015;6:3178-94. |
| 7. | Vance KW, Sansom SN, Lee S, Chalei V, Kong L, Cooper SE, et al. The long non-coding RNA Paupar regulates the expression of both local and distal genes. EMBO J 2014;33:296-311. |
| 8. | Yadegar N, Dadashi Z, Shams K, Mohammadi M, Abyar M, Rafat M. The prominent role of miR-942 in carcinogenesis of tumors. Adv Biomed Res 2022;11:63. [Full text] |
| 9. | Zhao Y, Srivastava D. A developmental view of microRNA function. Trends Biochem Sci 2007;32:189-97. |
| 10. | Bushati N, Cohen SM. microRNA functions. Annu Rev Cell Dev Biol 2007;23:175-205. |
| 11. | Jansson MD, Lund AH. MicroRNA and cancer. Mol Oncol 2012;6:590-610. |
| 12. | Cao W, Wei W, Zhan Z, Xie D, Xie Y, Xiao Q. Role of miR-647 in human gastric cancer suppression. Oncol Rep 2017;37:1401-11. |
| 13. | Wu J, Wang J. HMGN5 expression in bladder cancer tissue and its role on prognosis. Eur Rev Med Pharmacol Sci 2018;22:970-5. |
| 14. | Chamie K, Litwin MS, Bassett JC, Daskivich TJ, Lai J, Hanley JM, Konety BR, Saigal CS, Urologic Diseases in America Project. Recurrence of high-risk bladder cancer: A population-based analysis. Cancer. 2013;119:3219-27. |
| 15. | Du L, Wang X, Yin Y, Zhang Y, Jia J, Lu B, et al. Identification of a potentially functional circRNA-miRNA-mRNA ceRNA regulatory network in bladder cancer by analysis of microarray data. Transl Androl Urol 2021;10:24-36. |
| 16. | Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021;71:209-49. |
| 17. | Prabhu M, Eckert LO. Development of World Health Organization (WHO) recommendations for appropriate clinical trial endpoints for next-generation Human Papillomavirus (HPV) vaccines. Papillomavirus Res 2016;2:185-9. |
| 18. | Rodríguez AC, Schiffman M, Herrero R, Wacholder S, Hildesheim A, Castle PE, et al. Rapid clearance of human papillomavirus and implications for clinical focus on persistent infections. J Natl Cancer Inst 2008;100:513-7. |
| 19. | Vo N, Klein ME, Varlamova O, Keller DM, Yamamoto T, Goodman RH, et al. A cAMP-response element binding protein-induced microRNA regulates neuronal morphogenesis. Proc Natl Acad Sci 2005;102:16426-31. |
| 20. | Yang Z, Ma J, Han S, Li X, Guo H, Liu D. ZFAS1 exerts an oncogenic role via suppressing miR-647 in an m6A-dependent manner in cervical cancer. Onco Targets Ther 2020;13:11795-806. |
| 21. | Rawla P, Sunkara T, Barsouk A. Epidemiology of colorectal cancer: Incidence, mortality, survival, and risk factors. Prz Gastroenterol 2019;14:89-103. |
| 22. | Sostres C, Gargallo CJ, Lanas A. Aspirin, cyclooxygenase inhibition and colorectal cancer. World J Gastrointest Pharmacol Ther 2014;5:40-9. |
| 23. | Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin 2011;61:69-90. |
| 24. | Liu S, Qu D, Li W, He C, Li S, Wu G, et al. miR 647 and miR 1914 promote cancer progression equivalently by downregulating nuclear factor IX in colorectal cancer. Mol Med Rep 2022;25:197. |
| 25. | Sitarz R, Skierucha M, Mielko J, Offerhaus GJA, Maciejewski R, Polkowski WP. Gastric cancer: Epidemiology, prevention, classification, and treatment. Cancer Manag Res 2018;10:239-48. |
| 26. | Ye G, Huang K, Yu J, Zhao L, Zhu X, Yang Q, et al. MicroRNA-647 targets SRF-MYH9 axis to suppress invasion and metastasis of gastric cancer. Theranostics 2017;7:3338-53. |
| 27. | Zhang X, Zhang M, Wang G, Tian Y, He X. Tumor promoter role of miR 647 in gastric cancer via repression of TP73. Mol Med Rep 2018;18:3744-50. |
| 28. | Ma H, Wang P, Li Y, Yang Y, Zhan S, Gao Y. Decreased expression of serum miR-647 is associated with poor prognosis in gastric cancer. Int J Clin Exp Pathol 2019;12:2552-8. |
| 29. | Tan SK, Pastori C, Penas C, Komotar RJ, Ivan ME, Wahlestedt C, Ayad NG. Serum long noncoding RNA HOTAIR as a novel diagnostic and prognostic biomarker in glioblastoma multiforme. Molecular cancer. 2018 Dec; 17:1-7. |
| 30. | Wen PY, Kesari S. Malignant gliomas in adults. N Engl J Med 2008;359:492-507. |
| 31. | Qin K, Tian G, Chen G, Zhou D, Tang K. miR-647 inhibits glioma cell proliferation, colony formation and invasion by regulating HOXA9. J Gene Med 2020;22:e3153. |
| 32. | Blum HE. Hepatocellular carcinoma: Therapy and prevention. World J Gastroenterol 2005;11:7391-400. |
| 33. | Forner A, Reig M, Bruix J. Hepatocellular carcinoma. Lancet 2018;391:1301-14. |
| 34. | Lee JS. The mutational landscape of hepatocellular carcinoma. Clin Mol Hepatol 2015;21:220-9. |
| 35. | Ye X, Qiu R, He X, Hu Z, Zheng F, Huang X, et al. miR-647 inhibits hepatocellular carcinoma cell progression by targeting protein tyrosine phosphatase receptor type F. Bioengineered 2022;13:1090-102. |
| 36. | Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer 2015;136:E359-86. |
| 37. | van Meerbeeck JP, Fennell DA, De Ruysscher DKM. Small-cell lung cancer. Lancet 2011;378:1741-55. |
| 38. | Ferlay J, Steliarova-Foucher E, Lortet-Tieulent J, Rosso S, Coebergh JWW, Comber H, et al. Cancer incidence and mortality patterns in Europe: Estimates for 40 countries in 2012. Eur J Cancer 2013;49:1374-403. |
| 39. | Zhang YS, Chen T, Cai YJ, Dong J, Bai F, Gao X, et al. MicroRNA-647 promotes the therapeutic effectiveness of argon–helium cryoablation and inhibits cell proliferation through targeting TRAF2 via the NF-κB signaling pathway in non-small cell lung cancer. Onco Targets Ther 2018;11:6777-84. |
| 40. | Jiang W, Zhao X, Yang W. MiR-647 promotes cisplatin-induced cell apoptosis via downregulating IGF2 in non-small cell lung cancer. Minerva Med 2021;112:312-3. |
| 41. | Jayson GC, Kohn EC, Kitchener HC, Ledermann JA. Ovarian cancer. Lancet 2014;384:1376-88. |
| 42. | Matulonis UA, Sood AK, Fallowfield L, Howitt BE, Sehouli J, Karlan BY. Ovarian cancer. Nat Rev Dis Primers 2016;2:16061. |
| 43. | Tew WP, Muss HB, Kimmick GG, Von Gruenigen VE, Lichtman SM. Breast and ovarian cancer in the older woman. J Clin Oncol 2014;32:2553-61. |
| 44. | Longuespée R, Boyon C, Desmons A, Vinatier D, Leblanc E, Farré I, et al. Ovarian cancer molecular pathology. Cancer Metastasis Rev 2012;31:713-32. |
| 45. | Sun D, Liu J, Zhou L. Upregulation of circular RNA circ FAM53B predicts adverse prognosis and accelerates the progression of ovarian cancer via the miR 646/VAMP2 and miR 647/MDM2 signaling pathways. Oncol Rep 2019;42:2728-37. |
| 46. | Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin 2019;69:7-34. |
| 47. | Berger MF, Lawrence MS, Demichelis F, Drier Y, Cibulskis K, Sivachenko AY, et al. The genomic complexity of primary human prostate cancer. Nature 2011;470:214-20. |
| 48. | Wang G, Zhao D, Spring DJ, DePinho RA. Genetics and biology of prostate cancer. Genes Dev 2018;32:1105-40. |
| 49. | Chen W, Cen S, Zhou X, Yang T, Wu K, Zou L, et al. Circular RNA CircNOLC1, upregulated by NF-KappaB, promotes the progression of prostate cancer via miR-647/PAQR4 axis. Front Cell Dev Biol 2021;8:624764. |
[Figure 1]
[Table 1], [Table 2]
|
Search Pubmed for