|
Two distinct deleterious causative variants in a family with multiple cancer-affected patients
Erfan Khorram1, Mohammad A Tabatabaiefar2, Mehrdad Zeinalian1
1 Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
2 Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences; Pediatric Inherited Diseases Research Center, Research Institute for Primordial Prevention of Noncommunicable Disease, Isfahan University of Medical Sciences, Isfahan, Iran
| Date of Submission | 29-Oct-2022 |
| Date of Acceptance | 24-Jan-2023 |
| Date of Web Publication | 31-Jul-2023 |
Correspondence Address:
Dr. Mehrdad Zeinalian
Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, 81746-73461
Iran
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/abr.abr_366_22
Background: Only 5 to 10% of cancers are hereditary, but they are particularly important since they can be passed down from generation to generation, and family members are at elevated risk. Although screening methods are one of the essential strategies for dealing with hereditary cancers, they do not have high specificity and sensitivity. The emergence of whole-exome sequencing (WES) causes a significant increase in the diagnostic rate of cancer-causing variants in at-risk families.
Materials and Methods: We performed WES on the proband's DNA sample from an Iranian family with multiple cancer-affected members to identify potential causative variants. Multiple in silico tools were used to evaluate the candidate variants' pathogenicity and their effects on the protein's structure, function, and stability. Moreover, the candidate variants were co-segregated in the family with Sanger sequencing.
Results: The WES data analysis identified two pathogenic variants (CHEK2: NM_007194.4: c.538C>T, p.Arg180Cys and MLH1: NM_000249.4, c.844G>A, p.Ala282Thr). Sanger sequencing data showed each of the variants was incompletely segregated with phenotype, but both of them explained the patient's phenotype together. Also, the structural analysis demonstrated that due to the variant (c.538C>T), a salt bridge between arginine 180 and glutamic acid 149 was lost. Indeed, several protein stability tools described both variants as destabilizing.
Conclusion: Herein, we interestingly identify two distinct deleterious causative variants (CHEK2: NM_007194.4: c.538C>T, p.Arg180Cys and MLH1: NM_000249.4, c.844G>A, p.Ala282Thr) in a family with several cancer-affected members. Furthermore, this study's findings established the utility of WES in the genetic diagnostics of cancer.
Keywords: CHEK2, hereditary cancer syndrome, MLH1, whole-exome sequencing
How to cite this article:
Khorram E, Tabatabaiefar MA, Zeinalian M. Two distinct deleterious causative variants in a family with multiple cancer-affected patients. Adv Biomed Res 2023;12:203 |
How to cite this URL:
Khorram E, Tabatabaiefar MA, Zeinalian M. Two distinct deleterious causative variants in a family with multiple cancer-affected patients. Adv Biomed Res [serial online] 2023 [cited 2023 Sep 28];12:203. Available from: https://www.advbiores.net/text.asp?2023/12/1/203/382553 |
| Introduction | |  |
Cancer is currently the first or second most common cause of premature mortality in most countries in the world.[1] It imposes a great burden on societies and families, and the annual number of new cancer cases is projected to increase from 19.3 million in 2018 to 29.4 million in 2040 due to several factors, such as aging, population growth, accelerating socioeconomic development, and changes in the prevalence of associated risk factors.[2],[3]
Hereditary cancer-predisposing syndromes occur due to deleterious germline variants in specific genes, increasing the risk of developing various cancers or benign abnormalities. Hereditary cancer-predisposing syndromes account for only 5–10% of all malignancies, but they are particularly important because they are transmitted over generations.[4] According to International Agency for Research on Cancer, breast and colorectal cancer (CRC) are the most common (11.7%) and third-most common cancers (10%) in the world, respectively, and a significant portion of which occur due to germline variations.[5]
Defects in several genes can cause breast cancer and CRC, such as MLH1 and CHEK2, which are highly and moderately penetrated genes, respectively.[6],[7] CHEK2 (Checkpoint kinase 2) is a tumor suppressor gene and encodes a protein with 534 amino acids which consist of an SQ/TQ cluster domain (SCD) at the N-terminus, a forkhead-associated (FHA) domain, and a kinase domain (KD) at the C-terminus.[8] Germline deleterious variants in the CHEK2 gene, second to the BRCA1/2 genes, is the most common cause of breast cancer.[9] The lifetime risk of breast cancer for patients with heterozygous deleterious variants in the CHEK2 gene is 25 to 39%.[10] Also, they have an increased risk for extra breast cancers such as colorectal, prostate, kidney, and thyroid.[8] In addition, a few cases with different types of brain cancer, such as primary glioblastomas, oligodendrogliomas, and medulloblastomas, have been reported.[11] Different types of pathogenic variants in the CHEK2 gene, such as missense, nonsense, small and large deletion, as well as splice sites in association with cancers, have been reported.[10],[12]
The other gene, MLH1, is a tumor suppressor gene, in which its defects are the second most common cause of Lynch syndrome (LS).[13] Patients with heterozygous deleterious variants in the MLH1 gene have an elevated risk for CRC and endometrial cancers. Additionally, in these patients, the risk of developing breast, upper urothelial, biliary, ovarian, brain, and small bowel malignancies increases.[13] Besides genetic variants, epimutations in the MLH1 gene also predispose to malignancy, which phenotypically are the same as genetic deleterious variants.[14] The MLH1 methylation in overall CRC was 20.3%; in sporadic CRC and LS-related CRC, it was 18.7% and 16.4%, respectively.[15] Considering the high prevalence of LS-related cancers, screening methods are of particular importance for the early detection of people at-risk Individuals. Two widely used screening tools are Bethesda and Amsterdam II. Given that both criteria based on family history and clinical background have low sensitivity and specificity, they are insufficient screening tools.
Herein, we used whole-exome sequencing (WES) to investigate a potential causative variant in a family with multiple cancer-affected members and interestingly found that, in this family, two distinct deleterious causative variants (CHEK2: NM_007194.4: c.538C>T, p.Arg180Cys and MLH1: NM_001354630.1: c.844G>A, p.Ala41Thr) result in malignancy.
| Materials and Methods | | |
Family ascertainment and DNA isolation
A consanguineous family with eleven patients with CRC, ovary, brain, and breast cancer was recruited for this study [Figure 1]a. A comprehensive medical history was taken regarding the age-onset of cancer and disease progression from patients. Peripheral blood samples were obtained from the proband as well as other healthy and affected members. Genomic DNA was isolated using a FlexiGene DNA extraction kit (QIAGEN, Hilden, Germany) according to standard protocol. | Figure 1: Pedigree chart along with electropherograms, (a) Pedigree chart of the family shown in detail with age onset of cancers. (b) Electropherograms show that three (III-6, IV-2, IV-4, and IV-6) out of five patients (III-6, IV-2, IV-3, IV-4, and IV-6) were heterozygous for the variant (CHEK2: NM_007194.4: c. 538C > T, p.Arg180Cys). Patient IV-3 and other healthy members (III-4 and III-7) were homozygous for the wild-type variant. Also, conservation studies among different species showed that variant occurs in a conserved region. (c) The electropherogram image for the variant (MLH1: NM_000249.4, c. 844G > A, p.Ala282Thr) shows that three patients (III-6, IV-2, and IV-3) from the family are heterozygous carriers of this variant, and the other individuals are homozygous wild-type. Also, this variant is located in a conserved region among different species
Click here to view |
Whole-exome sequencing
WES was performed on the high-quality DNA sample of the proband (III-6). The paired-end DNA sequencing was performed using SureSelect Human All Exon V7 (Agilent Technologies, Inc., Santa Clara, CA, USA, by Novogene Co., Ltd., Hong Kong) and sequenced on an Illumina HiSeq 4000 with coverage of 100 X means depth (Illumine Inc., San Diego, CA, USA). Read alignment, variant calling, and annotation were performed using the Burrows–Wheeler aligner tool (BWA), Genome Analysis Toolkit (GATK), and Annovar, respectively. Also, variant filtering and downstream analysis were performed according to our previous study.[16]
Co-segregation study using Sanger sequencing
To confirm the candidate disease-causing variant, using Primer3 web service (https://primer3.ut.ee/), two pair primers including (F: AAATACCGAACATACAGCAAG; R: CAGCAACTTACTCATCTTTACTC) for the c.538C>T, variant and (F: TGAGGAGGGAGAATGTACTG; R: CTGTGCCTTGTACCTGTAAG) for the c.844G>A were designed. Also, these primers were evaluated for SNP absence via BLAT (https://genome.ucsc.edu/cgi-bin/hgBlat). The amplicons were visualized on agarose gel 1.5%, and, subsequently, bidirectional Sanger sequencing was performed using an ABI 3130 sequencer (Applied Biosystems—USA).
Structural modeling and protein stability assessment
The PDB file of the CHEK2 protein (PDB ID: 3i6w) was taken from the PDB database (https://www.rcsb.org/). The processes of visualization, mutagenesis, and structural analysis were done using the PyMOL Molecular Graphics System, version 2.2.3, Schrödinger, LLC. Also, several protein stability prediction servers such as MUpro (https://www.ics.uci.edu/~baldig/mutation.html), I-Mutant2.0 (https://folding.biofold.org/i-mutant/i-mutant2.0.html), SDM (http://marid.bioc.cam.ac.uk/sdm2/prediction), and DUET (http://biosig.unimelb.edu.au/duet/stability) were used to assess the variant effect on protein stability.
| Result | | |
Family description
As shown in the pedigree chart of the family [Figure 1]a, there were eleven affected members in three successive generations of the family. The proband (III-6) was a 69-year-old male patient who had manifested ductal breast carcinoma since he was 41 years old. In addition to the proband, four other members of the family (II-2, III-2, IV-2, and IV-6) suffered from ductal breast carcinoma. Also, five affected members suffered from extra breast cancers such as colorectal, ovary, and glioblastoma cancer, where the age onset of the disease in most of them was before the age of 50.
Genetic findings
WES data analysis revealed eight variants in genes that were consistent with the affected member phenotypes [Table 1]. Among these variants, according to ACMG guidelines for interpretation of sequence variants,[17] a pathogenic variant (CHEK2: NM_007194.4: c. 538C>T, p.Arg180Cys) and a likely pathogenic variant (MLH1: NM_000249.4, c.844G>A, p.Ala282Thr) were found, and the rest were benign or likely benign. The pathogenic variant (CHEK2: NM_007194.4: c.538C>T, p.Arg180Cys) frequency in heterozygous state in several population databases such as 1000 genome, gnomAD, Exac, and Iranom was 0.00199681, 0.0006187, 0.001360, and 0.00125, respectively (PM2). Furthermore, this variant is located in a conserved region between different species [Figure 1]b, and several pathogenicity predictive tools predicted [Table 2] the variant as pathogenic (PP3). This variant was previously reported as a deleterious variant (PP5).[8],[12] Also, a variant in this codon has already been reported, which leads to the substitution of histidine with arginine (PS1).[18] This variant has PP5, PS1, PP3, and PM2 criteria and, according to the ACMG guidelines, is categorized as pathogenic. A segregation study in affected and unaffected family members revealed that, with the exception of (IV-3), all affected members were heterozygous for the variant (NM_007194.4: c.538C>T: p.R180C). Additionally, none of the healthy individuals harbored the candidate variant [Figure 1]b. | Table 2: Pathogenicity assessment of the candidate variants. List of pathogenicity assessment tools which evaluated these candidate variants as pathogenic
Click here to view |
Due to the incomplete segregation of this variant, we candidate the other as a possible causative variant (MLH1: NM_000249.4, c.844G>A, p.Ala282Thr). In gnomAD, this variant frequency was 0.000003977, and it was absent in other population databases, such as 1000 genome, Exac, and Iranom (PM2). Also, this variant is conserved among species [Figure 1]c, and different pathogenicity assessment tools predicted this variant as pathogenic (PP3) [Table 2]. Previously, a deleterious variant (c.845C>G, p.Ala282Gly) in this codon in a patient with CRC has been reported (PS1).[19] By and large, this variant has PS1, PP3, and PM2 criteria and, according to the ACMG guidelines, is also categorized as pathogenic. Co-segregation study showed that the proband (III-6) and two other affected members of the family (IV-2, IV-3) were heterozygous for this variant; meanwhile, other members (III-4, III-7, IV-4, IV-6) were wild-type homozygous.
Structural and stability findings
Due to the variant (CHEK2: NM_007194.4: c.538C>T, p.Arg180Cys), arginine 180 was substituted with cysteine. Arginine is a basic amino acid that generally provides the salt bridge. Compared to the wild-type amino acid, the substituted amino acid (cysteine) is smaller in size and also has no electrical charge. Structural analysis showed that arginine 180 establishes an intramolecular salt bridge with the amino acid glutamine 149. This salt bridge is lost when the amino acid cysteine is replaced [Figure 2]. Also, protein stability studies using multiple tools such as SDM, DUET, I-Mutant2.0, and MUpro showed that both variants decrease the stability of the protein [Table 3]. | Figure 2: 3-D structure of the CHEK2 protein. (a) Structure of the CHEK2 protein in homodimerize state. (b) In wild-type structure arginine 180 established a salt bridge with glutamic acid 149. (c) In mutant form, due to the substitution of arginine with cysteine, the salt bridge is lost
Click here to view |
 | Table 3: Stability prediction of the candidate variants. Different stability prediction tools evaluated both of the variants (p.Arg180Cys, p.Ala282Thr) as destabilizing
Click here to view |
| Discussion | | |
Herein, we investigated a large pedigree with several affected members who suffered from different types of cancer, including ductal breast, colorectal, ovary, and brain cancer. WES data analysis revealed two distinct pathogenic variants in the CHEK2 and MLH1 genes [Table 1]. The pathogenic variant (CHEK2: NM_007194.4: c.538C>T, p.Arg180Cys) was a missense variant that results in the substitution of a basic amino acid (arginine) with a neutral amino acid (cysteine). Structural analysis has shown that the salt bridge between arginine 180 and glutamic acid 149 is lost as a result of this substitution [Figure 2]. Since salt bridges play a critical role in protein conformation, the CHEK2 protein is likely to lose its correct conformation and, subsequently, its function.[20] Co-segregation study showed, three (III-6, IV-2, and IV-4) out of four patients (III-6, IV-2, IV-4, and IV-6) who were heterozygous for the variant (CHEK2: NM_007194.4: c. 538 C>T: p.R180C), manifested breast cancer, and another patient (IV-6) suffered from glioblastoma. Although the literature review showed that breast cancer and glioblastoma had been reported in many patients with mutations in the CHEK2 gene,[6],[11] the absence of the variant in the patient (IV-3) led to incomplete co-segregation of the candidate variant. In the patient (IV-3), considering the positive family history and the early onset of the disease, there was a very low probability of developing sporadic CRC, so we performed a co-segregation study on the other variant (MLH1: NM_000249.4, c.844G>A, p.Ala282Thr). The proband (III-6), the patient (IV-2), and his affected sister (IV-3) were all heterozygous for this candidate variant, while the rest of the family members (III-4, III-7, IV-4, and IV-6) were homozygous for the wild-type variant. Due to the incomplete segregation of both candidate variants in the family, neither candidate variants alone are responsible for cancer in this family. Given that both candidate variants have previously been reported as causative deleterious variants,[8],[19] as well as there were no other pathogenic variants in the studied family, the manifested cancers are caused by both variants. The presence of two different disease-causing variants, which the proband inherited from his parents, who originated from a small population with a high rate of consanguineous marriage, is the main reason for a large number of affected individuals in this family. The majority of cancers are sporadic, and only a small percentage of cancers occur due to germline mutations; however, due to vertical transmission and the fact that family members' risk for developing cancer is higher compared to the general population, screening methods and early diagnosis have a special place.[21] There are many ways to deal with cancer; however, prevention and screening methods are more cost-effective than others. There are many screening tests for different cancers; for example, the mammography test is widely used for breast cancer.[22] For CRC, there are several screening tests, including Colonoscope, CT Colonoscopy, Sigmoidoscopy, Guideline Fecal Occult Blood Test (gFOBT), Multi-Targeted Fecal DNA (FIT-DNA), and SEPT9 Test. However, each of these tests has limited accuracy and sensitivity.[23] In addition to the screening methods already mentioned, the advent of whole-exome sequencing was a great revolution in the simultaneous analysis of cancer-related genes to find possible causative deleterious variants.[24]
In conclusion, we, by WES, investigated a large Iranian family with several cancer-affected patients and detected two distinct reported deleterious variants (CHEK2: NM_007194.4: c. 538C > T, p.Arg180Cys and MLH1: NM_000249.4, c. 844G > A, p.Ala282Thr) in the proband. Each of the two variants was not completely segregated, but the two variants explained the phenotype of the affected individuals together. This study also highlights the high application of WES to cancer diagnosis.
Acknowledgments
Hereby, we would like to express our special thanks to our patients and their family for participating in this study.
Ethics approval
The study was performed according to the Declaration of Helsinki and with the approval of the Institutional Review Board (IRB) of Isfahan University of Medical Sciences (IR.MUI.MED.REC.1398.711). Also, informed consent was obtained from all participants or their legal guardians.
Financial support and sponsorship
This study funding was supported by the Isfahan university of medical sciences.
Conflicts of interest
There are no conflicts of interest.
| References | | |
| 1. | Soerjomataram I, Bray F. Planning for tomorrow: Global cancer incidence and the role of prevention 2020–2070. Nat Rev Clin Oncol 2021;18:663–72.  |
| 2. | Wild CP. The global cancer burden: Necessity is the mother of prevention. Nat Rev Cancer 2019;19:123–4. |
| 3. | Cao W, Chen HD, Yu YW, Li N, Chen WQ. Changing profiles of cancer burden worldwide and in China: A secondary analysis of the global cancer statistics 2020. Chin Med J (Engl) 2021;134:783–91. |
| 4. | Heald B, Marquard J, Funchain P. Strategies for clinical implementation of screening for hereditary cancer syndromes. Semin Oncol 2016;43:609–14. |
| 5. | Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021;71:209–49. |
| 6. | Apostolou P, Papasotiriou I. Current perspectives on CHEK2 mutations in breast cancer. Breast Cancer (Dove Medical Press) 2017;9:331–5. |
| 7. | Bianchi F, Raponi M, Piva F, Viel A, Bearzi I, Galizia E, et al. An intronic mutation in MLH1 associated with familial colon and breast cancer. Fam Cancer 2011;10:27–35. |
| 8. | Kleibl Z, Havranek O, Hlavata I, Novotny J, Sevcik J, Pohlreich P, et al. The CHEK2 gene I157T mutation and other alterations in its proximity increase the risk of sporadic colorectal cancer in the Czech population. Eur J Cancer (Oxford, England: 1990) 2009;45:618–24. |
| 9. | Toss A, Tenedini E, Piombino C, Venturelli M, Marchi I, Gasparini E, et al. Clinicopathologic profile of breast cancer in germline ATM and CHEK2 mutation carriers. Genes (Basel) 2021;12:616. |
| 10. | Jalilvand M, Oloomi M, Najafipour R, Alizadeh SA, Saki N, Rad FS, et al. An association study between CHEK2 gene mutations and susceptibility to breast cancer. Comp Clin Pathol 2017;26:837–45. |
| 11. | Li X, Xue H, Luo N, Han T, Li M, Jia D. The first case report of a patient with oligodendroglioma harboring CHEK2 germline mutation. Front Genet 2022;13:718689. |
| 12. | Dong X, Wang L, Taniguchi K, Wang X, Cunningham JM, McDonnell SK, et al. Mutations in CHEK2 associated with prostate cancer risk. Am J Hum Genet 2003;72:270–80. |
| 13. | Yokoyama T, Takehara K, Sugimoto N, Kaneko K, Fujimoto E, Okazawa-Sakai M, et al. Lynch syndrome-associated endometrial carcinoma with MLH1 germline mutation and MLH1 promoter hypermethylation: A case report and literature review. BMC Cancer 2018;18:576. |
| 14. | Zyla R, Graham T, Aronson M, Velsher L, Mrkonjic M, Turashvili G. MLH1 epimutation is a rare mechanism for Lynch syndrome: A case report and review of the literature. Genes Chromosomes Cancer 2021;60:635–9. |
| 15. | Li X, Yao X, Wang Y, Hu F, Wang F, Jiang L, et al. MLH1 promoter methylation frequency in colorectal cancer patients and related clinicopathological and molecular features. PLoS One 2013;8:e59064. |
| 16. | Khorrami M, Khorram E, Yaghini O, Rezaei M, Hejazifar A, Iravani O, et al. Identification of a missense variant in the EIF2B3 gene causing vanishing white matter disease with antenatal-onset but mild symptoms and long-term survival. J Mol Neurosci 2021;71:2405–14. |
| 17. | Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015;17:405–24. |
| 18. | Desrichard A, Bidet Y, Uhrhammer N, Bignon YJ. CHEK2 contribution to hereditary breast cancer in non-BRCA families. Breast Cancer Res 2011;13:R119. |
| 19. | Shin YK, Heo SC, Shin JH, Hong SH, Ku JL, Yoo BC, et al. Germline mutations in MLH1, MSH2 and MSH6 in Korean hereditary non-polyposis colorectal cancer families. Hum Mutat 2004;24:351. |
| 20. | Ittisoponpisan S, Islam SA, Khanna T, Alhuzimi E, David A, Sternberg MJE. Can predicted protein 3D structures provide reliable insights into whether missense variants are disease associated? J Mol Bio 2019;431:2197–212. |
| 21. | Frank C, Fallah M, Sundquist J, Hemminki A, Hemminki K. Population landscape of familial cancer. Sci Rep 2015;5:12891. |
| 22. | Pinsky PF. Principles of cancer screening. Surg Clin North Am 2015;95:953–66. |
| 23. | Wu Z, Li Y, Zhang Y, Hu H, Wu T, Liu S, et al. Colorectal cancer screening methods and molecular markers for early detection. Technol Cancer Res Treat 2020;19:1533033820980426. |
| 24. | Shen T, Pajaro-Van de Stadt SH, Yeat NC, Lin JC. Clinical applications of next generation sequencing in cancer: From panels, to exomes, to genomes. Front Genet 2015;6:215. |
[Figure 1], [Figure 2]
[Table 1], [Table 2], [Table 3]
|
Search Pubmed for