Close
  Indian J Med Microbiol
 

Figure 1: Prediction of Optimal Secondary structure of the has-miR-942 (EPS format) with -56.70 kcal/mol with its dot-bracket notation using the Rfold web server. The sequence of this microRNA: ATTAGGAGAG TATCTTCTCTGTTTTGGCCA TGTGTGT ACTCACAGCC CCTCACACATGGCCGAAACAGAGAAGTTACTTTCCTAAT

Figure 1: Prediction of Optimal Secondary structure of the has-miR-942 (EPS format) with -56.70 kcal/mol with its dot-bracket notation using the Rfold web server. The sequence of this microRNA: ATTAGGAGAG TATCTTCTCTGTTTTGGCCA TGTGTGT ACTCACAGCC CCTCACACATGGCCGAAACAGAGAAGTTACTTTCCTAAT